Photos / Sounds

What

Typical Sawflies Superfamily Tenthredinoidea

Observer

rjennion

Date

December 2020

Description

They’re back...

Photos / Sounds

What

Common Sawflies Family Tenthredinidae

Observer

treichard

Date

October 30, 2020 03:00 PM EDT

Photos / Sounds

Observer

keimwj

Date

June 7, 2014 05:04 PM EDT

Description

07 Jun 2014.
Bowman's Hill Wildflower Preserve, Bucks Co, PA.
Larva.
Found on Verbesina alternifolia.

Photos / Sounds

Observer

sskorpio

Date

May 27, 2019 10:28 AM MSK

Description

Larva on spruce

Photos / Sounds

Observer

danabrennan

Date

May 28, 2020 12:47 PM AKDT

Description

Host is Alaskan paper birch. Lifescanner ID Eriocraniidae from BOLD-F37. DNA barcode: COI-5P
AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATGCCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCG-

Photos / Sounds

What

Elm Zigzag Sawfly Aproceros leucopoda

Observer

alainhogue

Date

July 30, 2020 08:41 PM EDT

Description

Ulmus

Photos / Sounds

What

Common Sawflies Family Tenthredinidae

Observer

trailblazr

Date

March 7, 2020 12:15 PM HST

Photos / Sounds

Observer

woodmen19

Date

June 13, 2017 04:03 AM MSK

Photos / Sounds

What

Common Sawflies Family Tenthredinidae

Observer

cyanided

Date

January 22, 2020 05:19 PM CST

Photos / Sounds

Observer

debbie-seabrook

Date

November 24, 2019 02:16 PM EST

Photos / Sounds

Observer

richardlbaxter

Date

June 3, 2017 11:02 AM EDT

Description

Freshly hatched larvae feeding on what looks like cottonwood, not sure if these are hymenopterans or lepidopterans

Photos / Sounds

Observer

treichard

Date

July 2, 2019 11:55 PM EDT

Photos / Sounds

What

Club-horned Sawflies Family Cimbicidae

Date

July 24, 2019 02:56 PM EDT

Photos / Sounds

Observer

jasonheadley

Date

June 17, 2019 03:41 PM PDT

Photos / Sounds

What

Pigeon Horntail Tremex columba

Observer

melissaeldridge

Date

September 3, 2019 03:30 PM EDT

Description

Insect pupa found in firewood log in Shenandoah National Park. The firewood was bought in the park. Between 1” and 1.5” in length. Long antennae, legs, and abdomen. Suspected to be Pigeon Tremex Horntail pupa.

Photos / Sounds

What

Pigeon Horntail Tremex columba

Observer

nearctic

Date

September 1, 2019 11:32 AM EDT

Description

Dead. Ovipositor lodged in a birch.

Photos / Sounds

Observer

humanbyweight

Date

April 2009

Photos / Sounds

Date

April 12, 2018 06:07 PM EDT

Description

Feeding on swamp chestnut oak. Parasatoid wasps regularly laying eggs in some individuals of this species.

Photos / Sounds

Observer

nakarb

Date

May 8, 2015 11:28 AM MSK