June 23, 2023

COI genetic data of Land Snail in South Korea.

COI genetic data of Land Snail in South Korea.
I hope more snail strains are identified and sorted out.

Acusta redfieldi Daejeon LinK

TAACGTAATTGTGACCGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTTGGTAATTGAATAGTTCCACTTTTAATTGGGGCTCCTGATATGAGCTTTCCCCGTATAAATAATATAAGGTTTTGATTGTTACCTCCTTCTTTTGTTTTACTAATTAGAAGAAGGTTAGTTGAAGGTGGGGCTGGAACCGGTTGGACCGTTTACCCGCCGCTAAGATCATTGACTGGCCATAGTGGCGCTTCGGTGGATTTAGCTATTTTTTCTCTACACTTAGCTGGAATATCTTCTATTTTAGGAGCCATTAACTTTATCACTACTATTTTTAATATACGGGCCCCAGGAATTACAATAGAACGAGTGAGTTT

Acusta redfieldi Gaduck LinK

TAACGTAATTGTGACCGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTTGGTAATTGAATAGTTCCACTTTTAATTGGGGCTCCTGATATGAGCTTTCCCCGTATAAATAATATAAGGTTTTGATTGTTACCTCCTTCTTTTGTTTTACTAATTAGAAGAAGGTTAGTTGAAGGTGGGGCTGGAACTGGTTGGACCGTTTACCCGCCGCTAAGATCATTGACTGGCCATAGTGGCGCTTCGGTGGATTTAGCTATTTTTTCTCTACACTTAGCTGGAATATCTTCTATTTTAGGAGCCATTAACTTTATCACTACTATTTTTAATATACGGGCCCCAGGAATTACAATAGAACGAGTGAGTTT

Acusta redfieldi Kim Sung

TAATGTAATTGTGACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTTGGTAATTGAATAGTTCCACTTTTAATTGGGGCTCCTGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCTCCTTCTTTTGTTTTGCTCATTAGAAGAAGGTTAGTTGAAGGTGGGGCTGGAACGGGGTGAACAGTTTACCCGCCGCTAAGATCATTAACTGGCCATAGTGGCGCTTCGGTAGATTTAGCTATTTTTTCTCTGCATTTAGCTGGAATATCTTCTATTTTAGGGGCTATTAACTTTATTACCACTATTTTTAATATGCGGGCCCCGGGAATTACAATAGAACGGGTAAGTTT

Acusta redfieldi LinK

TAACGTAATGGTAACCGCTCATGCGTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGTGGTTTTGGAAATTGAATAGTTCCGCTTTTAATTGGGGCTCCCGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCACCTGCCTTTGTTTTACTAATTAGAAGAAGGTTAGTTGAAGGAGGAGCGGGAACGGGTTGAACCGTTTACCCGCCGTTGAGATCATTGACTGGCCATAGCGGCCCTGCGGTCGATTTAGCGATTTTTTCTCTGCACCTTGCGGGCCTATCTTCTATTTTGGGCGCCATCAACTTTATTACTACGATTTTCAATATGCGCGCCCCCGGAATGACAATAGAACGGGTGAGCCT

Acusta redfieldi 1 Kim Sung

TAATGTAATTGTGACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATAATGATTGGAGGTTTTGGTAATTGAATAGTTCCGTTAATAATTGGGGCTCCTGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCTCCTTCCCTTGTTTTGCTCATTATAAGAAGGTTAGTAGAGGGTGGGGCTGGAACGGGGAGAACAGTTTTCCCCCCCATAAGATCATTAACTGGCCATAGTGGGGGGTCGGTAGATTTAGCTATTTTCTCTCTGCATTTAGCTGGAATATCTTCTATTTTAGGGGCTATTAATTTTATTACCACTATTTTTAATATGCGGGCCCCGGGAATTCCAATAGAGCGTGTAAGTTT

Aegista chejuensis 2 Kim Sung

TAATGTAATCGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATTGAATAGTTCCTTTATTAATTGGAGCTCCTGATATAAGTTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCTCCTTCATTTATTTTATTAATTTCTAGAAGGTTAGTTGAGGGTGGAGCTGGTACTGGATGAACAGTATATCCACCTTTAAGTTCTATTGTAGGTCATAGAGGTGCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTGGCTGGGATATCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTTTTAATATACGTAGTCCAGGAATTTCATTAGAACGAATAAGTTT

Aegista gottschei Fusan Noon-noon-i

TAATGTTATTGTAACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGGAATTGAATAGTTCCATTATTAATTGGGGCTCCAGATATAAGTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCGCCATCATTTATTTTATTAATTTCAAGAAGATTAATTGAAGGCGGAGCTGGAACAGGATGAACAGTATATCCACCTTTAAGTTCTCTTACAGGACATAGAGGTGCTTCAGTGGATTTAGCTATTTTTTCTCTACATCTAGCTGGGATATCTTCTATTTTAGGTGCTATTAATTTTATTACTACAATTTTTAATATACGTAGACCAGGGATTTCTATAGAACGAATAAGACT

Ambigolimax valentianus LinK

TAATGTGATTGTAACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGGTTTGGAAATTGAATAGTCCCACTTTTAATTGGGGCCCCCGATATAAGGTTTCCTCGGATAAATAATATAAGTTTTTGATTACTACCGCCGTCTTTTATTTTATTAATTTGCTCTAGAATGGTAGAAGGTGGGGCTGGAACAGGGTGAACTGTATACCCCCCATTAAGTGGCCCTTTAGGTCATGGTGGAGCTTCAGTTGATCTAGCTATTTTTTCTTTACATTTGGCGGGTATATCTTCTATTTTGGGTGCAATTAATTTTATTACTACTATTTTTAATATACGCTCTCCAGGGATGACAATAGAACGTGTAAGTTT

Bekkochlamys quelpartensis Kim Wan-byeng

TAATGTAATTGTAACTGCTCATGCTTTCGTTATAATTTTCTTCATAGTTATACCTATTATAATTGGTGGGTTTGGAAATTGAATGGTTCCTTTATTAATTGGAGCGCCAGATATAAGGTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTTATTTTTCTTATTTGCTCAAGTATAGTAGAAGGTGGAGCCGGAACAGGATGGACAGTATATCCCCCTCTTAGAGGTCCTGTAGGACATGCGGGAGCATCAGTTGATCTTGCTATTTTCTCATTACATTTAGCAGGTATGTCTTCTATTTTAGGGGCTATTAATTTTATTACAACTATCTTCAACATACGTTCACCAGGAATAACAATGGAACGTGTAAGATT

Bekkochlamys quelpartensis Love Joomma

TAATGTAATTGTAACTGCTCATGCTTTCGTTATAATTTTCTTCATAGTTATACCTATTATAATTGGTGGGTTTGGAAATTGAATGGTTCCTTTATTAATTGGAGCGCCAGATATAAGGTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTTATTTTTCTTATTTGCTCAAGTATAGTAGAAGGTGGAGCCGGAACAGGATGGACAGTATATCCCCCTCTTAGAGGTCCTGTAGGACATGCGGGAGCATCAGTTGATCTTGCTATTTTCTCATTACATTTAGCAGGTATGTCTTCTATTTTAGGGGCTATTAATTTTATTACAACTATCTTCAACATACGTTCACCAGGAATAACAATGGAACGTGTAAGATT

Bekkochlamys subrejecta Haneul

TAATGTAATTGTAACTGCTCATGCATTTGTTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGAATAGTTCCTTTATTAATTGGAGCACCTGATATAAGATTTCCACGAATAAATAATATAAGATTTTGATTACTTCCGCCTTCATTTATTTTTCTTATTTGTTCAAGTATGGTTGAAGGGGGTGCAGGAACAGGTTGAACAGTTTATCCGCCTTTAAGAGGGCCAATAGGGCATGCTGGTGCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATATCTTCTATTTTAGGGGCAATTAATTTTATTACAACTATTTTTAATATACGATCTCCTGGAATAACTATGGAACGTGTAAGGTT

Chosenelix problematica 1 LinK

CAATGTTATTGTGACTGCCCACGCTTTTGTTATAATTTTTTTTATGGTTATGCCAATTATAATTGGTGGTTTTGGTAATTGAATGGTACCTTTATTGATCGGCGCCCCTGATATAAGTTTTCCCCGAATGAATAATATAAGATTTTGATTACTTCCTCCTTCTTTTATTCTTCTTATTAGAAGAAGGTTGGTAGAAGGGGGTGCTGGTACCGGGTGGACTGTTTACCCGCCTCTAAGGACTTTAACGGGGCATAGGGGAGCTTCCGTGGATTTAGCTATTTTCTCCCTACACCTGGCGGGGGTTTCTTCCATCCTTGGGGCTATTAATTTTATTACTACTATTTTTAACATACGTGCACCAGGTATAACTATAGAACGTGTAAGTTT

Chosenelix problematica 2 LinK

CAATGTTATTGTGACCGCTCACGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTATAATTGGTGGTTTTGGTAATTGAATGGTACCTTTATTAATCGGGGCTCCCGATATAAGTTTTCCCCGGATGAATAATATAAGGTTTTGATTACTTCCTCCCTCCTTTATTCTACTTATTAGTAGGAGATTGGTAGAGGGAGGTGCTGGTACCGGGTGAACTGTTTACCCTCCTCTGAGGACTTTAACGGGACATAGGGGAGCTTCCGTGGATTTAGCTATTTTCTCTTTACATTTGGCGGGGGTGTCCTCCATCCTTGGGGCTATTAATTTTATTACTACTATCTTTAACATACGCGCACCAGGTATAACAATAGAACGTGTAAGTTT

Chosenelix problematica 3 LinK

CAATGTTATTGTGACCGCTCACGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTATAATTGGTGGTTTTGGTAATTGAATGGTACCTTTATTAATCGGGGCTCCCGATATAAGTTTTCCCCGGATGAATAATATAAGGTTTTGATTACTTCCTCCCTCCTTTATTCTACTTATTAGTAGGAGATTGGTAGAGGGAGGTGCTGGTACCGGGTGAACTGTTTACCCTCCTCTGAGGACTTTAACGGGACATAGGGGAGCTTCCGTGGATTTAGCTATTTTCTCTTTACATTTGGCGGGGGTGTCCTCCATCCTTGGGGCTATTAATTTTATTACTACTATCTTTAACATACGCGCACCAGGTATAACAATAGAACGTGTAAGTTT

Chosenelix sp1 Kim Sung

TAATGTTATTGTAACTGCCCATGCATTTGTTATGATTTTTTTTATGGTGATACCTATTATAATTGGAGGTTTCGGTAATTGAATAGTACCTTTGTTAATTGGGGCCCCAGATATAAGTTTTCCACGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCTTTTATTTTACTTATTAGAAGTAGTTTAGTAGAAGGTGGTGCCGGTACTGGTTGAACTGTATACCCACCGTTAAGTACTTTAACTGGGCATAGGGGAGCCTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATGTCCTCTATTCTTGGGGCTATTAATTTTATTACTACTATTTTTAATATGCGGGCACCAGGTATATCTATAGAACGTGTAAGTTT

Deroceras laeve LinK

TAATGTTGTAGTAACAGCACATGCATTTGTTATAATTTTTTTTATAGTGATACCAATTATAATTGGGGGATTTGGTAACTGGATGGTACCTTTGCTAATTGGTGCTCCGGACATAAGATTTCCTCGTATAAATAATATAAGTTTTTGGTTATTACCTCCTTCATTTTTATTATTAATTTGTTCTAGAATAGTGGAGGGTGGAGCAGGAACTGGGTGAACAGTTTATCCTCCACTTAGTGGTCCATTAGGGCATGCAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATTTGGCTGGTATATCCTCTATTTTAGGTGCTATTAATTTTATTACTACAATTTTTAATATACGCTCACCTGGTTTGAGTATAGAACGTGTTAGTTT

Discus pauper Seungyeon

TAATGTTATTGTGACTGCCCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATGATTGGGGGATTTGGAAATTGAATAGTGCCTTTACTTTTAGGGGCACCAGATATAAGCTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCACCAGCTTTTGTATTATTAATTGTTTCTAGTATAGTGGAAGGGGGGGCAGGTACTGGTTGAACCGTTTACCCTCCCTTAAGGGGTATTACTGGTCATAGAGGTGCATCAGTAGATTTAGCAATTTTTTCTCTACATCTTGCAGGTATATCTTCAATTTTAGGTTCAATTAATTTTATTACCACTATTTTTAATATGCGATCACCAGGGTTAACCTTAGAACGAATAAGATT

Euhadra dixoni jeju LinK

CAATGTAATTGTCACGGCGCATGCGTTTGTTATAATTTTTTTCATAGTGATACCTATTATAATTGGTGGTTTTGGGAACTGAATAGTACCGTTGTTAATTGGTGCGCCAGATATAAGGTTTCCGCGTATGAATAACATGAGTTTTTGGCTTTTACCCCCCTCTTTTGTATTACTAATCTCAAGTAGTTTGGTTGAGGGCGGTGCGGGTACAGGTTGGACTGTCTATCCGCCCTTAAGTTCTTTAACAGGGCATAGTGGTGCTTCTGTAGATTTGGCTATTTTTTCACTTCACTTGGCGGGTATATCTTCAATTTTGGGTGCCATTAATTTTATTACTACCATTTTTAACATACGCGCTCCGGGGGTAACTATGGAACGTTTAAGATT

Euhadra herklotsi LinK

CAATGTTATTGTTACTGCTCATGCATTCGTTATAATTTTCTTTATAGTTATACCTATTATAATTGGTGGGTTTGGAAATTGAATAGTTCCATTACTAATTGGTGCACCGGACATGAGCTTTCCACGTATAAATAACATAAGATTCTGACTTTTACCGCCTTCTTTTGTATTATTAATTTCCAGAAGGTTAGTTGAAGGTGGTGCCGGTACAGGTTGAACTGTGTACCCGCCATTAAGCTCATTGACAGGACATAGTGGAGCTTCTGTGGATTTGGCTATTTTTTCCCTTCATTTAGCAGGGATATCATCTATTTTGGGGGCTATTAATTTTATTACTACTATTTTTAATATACGTGCTCCAGGGGTTACTATAGAACGTTTGAGTTT

Karaftohelix kurodana LinK

TAATGTTATTGTGACAGCGCATGCTTTCGTAATAATTTTTTTCATAGTTATACCAATTATAATTGGCGGTTTTGGTAACTGAATAGTACCTTTACTTATTGGGGCTCCTGATATAAGTTTCCCACGAATGAATAACATAAGATTCTGGTTGTTACCGCCGTCTTTTGTTTTATTAATTAGTAGCTCTTTAGTAGAAGGAGGTGCGGGTACTGGTTGAACTGTATACCCTCCTCTTAGTGCTTTGACAGGACACAGTGGAGCCTCCGTGGACCTGGCTATTTTCTCCTTACATTTGGCAGGTATATCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCTTTAATATACGGGGACCTGGTATCACAATGGAACGATTAAGCCT

Macrochlamys indica Seungyeon

TAATGTTATTGTTACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGGTTTGGAAACTGAATAGTTCCTTTATTAATTGGAGCACCTGACATAAGTTTTCCACGAATAAATAATATAAGGTTTTGATTACTTCCACCTTCATTTATTTTTCTTATTTGCTCTAGAATAGTTGAAGGTGGAGCTGGAACTGGGTGAACTGTATATCCCCCTCTAAGAGGTTCTATTGGTCATGCAGGGGCATCAGTTGATTTGGCTATTTTTTCACTACATTTGGCTGGAATATCTTCTATTTTAGGTGCAATTAACTTTATTACTACTATTTTTAATATACGAGCTCCTGGAATTACAATAGAACGAGTAAGGTT

Meghimatium hongdoensis LinK

TAATGTCATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTGATACCAATAATGATTGGGGGGTTTGGTAATTGACTGGTCCCCCTATTAATTGGGGCCCCAGATATAAGTTTCCCTCGAATAAATAATATAAGATTCTGGCTCTTACCTCCTGCTTTATTATTACTAATTTGTAGCAGTTTAGTTGAAGGTGGGGCTGGAACTGGTTGAACGGTTTACCCTCCCTTGAGGGCTACTTTAGGTCATAATAACGCGTCGGTTGACCTAGCTATTTTTTCTTTGCATCTGGCAGGGATTTCTTCTATCCTAGGGGCGATTAATTTTATTTCCACCATTTTTAACATACGAGCTCCGTTATTAACATTGGAGCGCATAAGGCT

Meghimatium sp LinK

CAATGTAATTGTGACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGGGGGTTTGGAAATTGATTGGTTCCATTACTTATTGGTGCGCCTGACATAAGTTTTCCTCGAATAAATAATATAAGGTTTTGATTACTACCTCCTGCTTTAATTTTATTAATTTGCAGTAGAATAGTAGAAAGAGGTGCCGGAACCGGCTGAACAGTGTATCCACCATTAAGCTCCACTTTAGGCCATAATAATGCCTCAGTTGACTTAGCTATTTTTTCTTTGCATTTGGCAGGTATTTCCTCCATTTTGGGGGCTATTAATTTTATTTCAACTATTATTAACATACGAGCACCTCTATTAACCATAGAACGGTTAAGTTT

Nesiohelix samarangae Chungyang LinK

TAATGTAATTGTAACTGCTCATGCCTTCGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGGATAGTACCCTTATTAATTGGGGCTCCAGATATAAGATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTTATTTTATTGATTAGGAGAAGATTAGTAGAAGGGGGGGCAGGTACAGGATGAACTGTATACCCTCCCCTTAGCTCTTTGACTGGTCATAGTGGAGCTTCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATATCTTCCATTTTAGGGGCAATTAATTTTATTACTACTATTTTTAATATACGATCACCAGGAATATCAATAGAACGGGTAAGATT

Nesiohelix samarangae Gerje LinK

TAATGTAATTGTAACTGCTCATGCCTTCGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGGATAGTACCCTTATTAATTGGGGCTCCAGATATAAGATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTTATTTTATTGATTAGGAGAAGATTAGTAGAAGGGGGGGCAGGTACAGGATGAACTGTATACCCTCCCCTTAGCTCTTTGACTGGTCATAGTGGAGCTTCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATATCTTCCATTTTAGGGGCAATTAATTTTATTACTACTATTTTTAATATACGATCACCAGGAATATCAATAGAACGGGTAAGATT

Q Jeju Kim Wan-byeng

TAATGTAGTTGTTACTGCTCATGCTTTTGTGATAATCTTTTTTATGGTAATACCTATCATGATTGGAGGGTTTGGAAATTGAATAGTACCTTTATTGATTGGGGCTCCCGATATAAGATTTCCTCGAATAAATAACATAAGTTTCTGATTATTACCTCCCTCTTTTATTCTGTTAATTTCAAGAAGGATAGTCGAAGGCGGTGCCGGAACAGGTTGAACAGTTTACCCTCCACTTAGAAGTCTTATTGGCCACGGTGGAGCATCTGTTGATTTAGCAATCTTTTCTCTACACATGGCTGGACTAAGCTCAATTCTTGGGGCTATTAATTTTATCACCACAATTTTTAACATGCGAAGACCAGGGGTAACTTGGGAGCGTCTAAGGTT

Satsuma myomphala LinK

TAATGTAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTGATGCCGATTATGATTGGAGGGTTTGGTAACTGAATGGTACCCTTGTTAATTGGGGCTCCGGACATGATTTTTCCCCGTATAAATAATATAAATTTCTGGCTTTTACCACCTTCTTTTATTTTATTGATT-GTAGAAGCTTAGTTGAGGGTGGAGCAGGAACTGGGTGAACTGTTTACCCTCCTCTTAGGGCTATTGCTGGACATAGAGGTGCATCAGTTGATATAGCTATTTTTTCTTTACATCTGGCTGGGATGTCCTCTATTCTAGGGGCCATTAATTTTATTACCACTATTTTTAATATACGATCTCCTGGATTAACGTGGGAACGCATAAGGTT

SK Acusta redfieldi Kim Hyun

TAACGTAATTGTTACCGCCCATGCTTTTGTTATAATTTTTTTTATGGTAATACCTATTATGATTGGTGGTTTTGGAAATTGAATAGTTCCACTTTTAATTGGGGCGCCCGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCGCCCGCCTTTGTTTTACTAATTAGTAGAAGGTTAGTTGAAGGAGGAGTAGGAACGGGGTGGACCGTTTACCCGCCGTTGAGATCATTGACTGGACATAGCGGACCTGCGGTAGATTTAGCGATTTTTTCTCTGCACCTGGCCGGCTTATCCTCTATTTTAGGAGCCATCAACTTTATTACGACGATTTTTAATATGCGCTCCCCCGGAATGACAATAGAACGGGTTAGCCT



Posted on June 23, 2023 10:06 PM by pintail pintail | 0 comments | Leave a comment

April 04, 2023

Record a new group of the genus Hynobius.

In September 2012, when I was looking for HC4, I also found a group of HC5.
HC4 was registered as a species as Hynobius perplicatus in 2020 by Amael.

At this time, groups were found in Boseong, Goheung, and Yeongam, and later individuals of the genus Hynobius with the same gene were found in Namwon.

https://www.inaturalist.org/observations?verifiable=any&place_id=any&field:HC5

On the page above you can see the locations of individuals identified as HC5, but not all genes are listed below.

HC5_GH-6
GGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTTGGGGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACAAGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCGCGAATGAATAACATACGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCCTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATTAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACCGAAACCTTAATACTACATTCTTCGACCCTGC-
HC5_NW-2
TGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCTGGGACTCTTCTTGGGGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATGGTAATTCCAGTGATAATCGGAAGTTTTGGGAACCGGTTAGTTCCATTAATAATCGGCGCCCCGGACATAGCATTTCCGCCAATGAATAACATAAGTTTTTGGCTATTACCCCCGTCATTTCTTTTATTATTAACATCATCCGGGGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAACAGGGAACTTAACACATGCCGGAACCTCCGTTGATTTAACAATTTTTTCACTACATTTAACAGGTATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCTCCATTAATATAAAACCCCTATCAATATCCCAATATCAAACACCTTTATTTGTTTGATCCGTATTAATTACTGCTATTCTTCTTTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACCGAAACCTTAATACTACATTCTTCGACCCTGC-
HC5_PS-1
GGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTTGGGGATGATCAAATTTATAATGTAATTATAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACAAGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCGCGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCCTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATTAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACCGAAACCTTAATACTACATTCTTCGACCCTGC-
HC5_YA-2
GGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTTGGGGATGATCACATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATATTTTTTTTTATAGTAATACCAGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCGCGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCCTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTATTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATTAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACCGAAACCTTAATACTACATTCTTCGACCCTGC-

Posted on April 04, 2023 11:18 PM by pintail pintail | 0 comments | Leave a comment

September 28, 2022

A common snail that lives in the freshwater areas of Korea has been identified as Acusta redfieldi.

A common snail that lives in the freshwater areas of Korea has been identified as Acusta redfieldi. Based on the paper published by Hwang of Taiwan in 2020, the results were obtained as a result of drawing a phylogenetic tree by analyzing the COI genes of snails collected by Jae-Hoon Kim and Su-Min Seong in Korea in 2022.

Chosenelix problematica was found to be inhabited in Gangwon-do, and it is thought to be the same species as the yellow-colored individuals of the West Sea. Also, Chosenelix problematica is likely to coexist with Acusta redfeildi all over the country, Jaehoon Kim said.

Once again, I would like to express my sincere gratitude to Jaehoon Kim and Sumin Seong, who worked hard to collect for one year in 2022.

https://cafe.naver.com/yangpakor/45126?boardType=I

02 Gangwon Chosenelix problematica 1
TATATACTTTTTGGAGTTTGATGTGGTATAATTGGTACTGGTCTTAGTTTACTAATTCGTATAGAATTAGGCACTACAGGTGTACTATCCGATGAGCATTTTTATAATGTTATTGTAACTGCCCATGCATTTGTTATGATTTTTTTTATGGTGATACCTATTATAATTGGAGGTTTCGGTAATTGAATAGTACCTTTGTTAATTGGGGCCCCAGATATAAGTTTTCCACGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCTTTTATTTTACTTATTAGAAGTAGTTTAGTAGAAGGTGGTGCCGGTACTGGTTGAACTGTATACCCACCGTTAAGTACTTTAACTGGGCATAGGGGAGCCTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATGTCCTCTATTCTTGGGGCTATTAATTTTATTACTACTATTTTTAATATGCGGGCACCAGGTATATCTATAGAACGTGTAAGTTTATTTGTTTGGTCTATTCTTATTACGGTGTTCTTGTTGCTTCTATCCCTGCCAGTTCTGGCTGGTGCTATTACTATACTTTTAACAGATCGTAATTT
03 Gangwon Chosenelix problematica 2
TATATACTTTTTGGAGTTTGATGTGGTATAATTGGTACTGGTCTTAGTTTACTAATTCGTATAGAATTAGGCACTACAGGTGTACTATCCGATGAGCATTTTTATAATGTTATTGTAACTGCCCATGCATTTGTTATGATTTTTTTTATGGTGATACCTATTATAATTGGAGGTTTCGGTAATTGAATAGTACCTTTGTTAATTGGGGCCCCAGATATAAGTTTTCCACGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCTTTTATTTTACTTATTAGAAGTAGTTTAGTAGAAGGTGGTGCCGGTACTGGTTGAACTGTATACCCACCGTTAAGTACTTTAACTGGGCATAGGGGAGCCTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATGTCCTCTATTCTTGGGGCTATTAATTTTATTACTACTATTTTTAATATGCGGGCACCAGGTATATCTATAGAACGTGTAAGTTTATTTGTTTGGTCTATTCTTATTACGGTGTTCTTGTTGCTTCTATCCTTGCCAGTTCTGGCTGGTGCTATTACTATACTTTTAACAGATCGTAATTT
04 Daejeon Acusta despecta sieboldiana
TATATATTGTTTGGTGTGTGATGTGGTATAGTCGGAACTGGTTTAAGATTGTTAATTCGTATAGAGTTAGGAACTTCAGGAGTTTTAAGGGATGAGCATTTTTTTAACGTAATTGTGACCGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTTGGTAATTGAATAGTTCCACTTTTAATTGGGGCTCCTGATATGAGCTTTCCCCGTATAAATAATATAAGGTTTTGATTGTTACCTCCTTCTTTTGTTTTACTAATTAGAAGAAGGTTAGTTGAAGGTGGGGCTGGAACCGGTTGGACCGTTTACCCGCCGCTAAGATCATTGACTGGCCATAGTGGCGCTTCGGTGGATTTAGCTATTTTTTCTCTACACTTAGCTGGAATATCTTCTATTTTAGGAGCCATTAACTTTATCACTACTATTTTTAATATACGGGCCCCAGGAATTACAATAGAACGAGTGAGTTTATTCGTATGGTCGATTTTAATTACAGTTTTTTTATTATTGTTGTCTCTACCTGTACTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT
05 Jeju Acusta despecta sieboldiana
TATATATTGTTCGGTGTGTGGTGTGGTATAGTCGGAACTGGTTTGAGGTTGTTAATTCGTATAGAGTTAGGAACTTCGGGAGTTTTAAGGGATGAACATTTTTTTAATGTAATTGTGACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTTGGTAATTGAATAGTTCCACTTTTAATTGGGGCTCCTGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCTCCTTCTTTTGTTTTGCTCATTAGAAGAAGGTTAGTTGAAGGTGGGGCTGGAACGGGGTGAACAGTTTACCCGCCGCTAAGATCATTAACTGGCCATAGTGGCGCTTCGGTAGATTTAGCTATTTTTTCTCTGCATTTAGCTGGAATATCTTCTATTTTAGGGGCTATTAACTTTATTACCACTATTTTTAATATGCGGGCCCCGGGAATTACAATAGAACGGGTAAGTTTATTCGTATGGTCGATTTTAGTTACAGTTTTTTTATTATTGTTATCCCTACCTGTGCTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT
06 Jeju Acusta despecta sieboldiana
TATATATTGTTCGGAGTGTGGGGTGGTATAGTCGGAACTGTAATGAGGTTGATTATTCGTATAGAGTTAGGAACTTCGGGAGTTTTAAGGGATGAACATTTTATTAATGTAATTGTGACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTCATACCTATAATGATTGGAGGTTTTGGTAATTGAATAGTTCCGTTAATAATTGGGGCTCCTGATATGAGCTTTCCTCGTATAAATAATATAAGGTTTTGATTATTGCCTCcTTCCCTtGTTTTGCTCATTATAAGAAGGTTAGTAGAGGGtGGGGCTGGAACGGGGAGAACAGTTTTCCCCCCCATAAGATCATTAACTGGCCATAGTGGGGGGTCGGTAGATTTAGCTATTTTCTcTCTGCATTTAGCTGGAATATCTTCTATTTTAGGGGCTATTAATTTTATTACCACTATTTTTAATATGCGGGCCCCGGGAATTCCAATAGAGCGTGTAAGTTTATTTGTATGGTCGATTTTAGTTACAGCAATTTTATTATTGCTATCCTTACCTGTGTTAGCAGGAGCTATTACAATATTATTAACAGATCGTAATTT
07 Jeju Platyraphe minutus quelpartensis
TATATACTATTTGGAATTTGATGTGGGATGGTCGGGACCGGTCTTTCCCTTTTAATCCGTCTAGAATTAGGAACTTCAGGTGTATTAATAGATGATCATTTTTTTAATGTCATTGTTACGGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCCGTTATAATTGGTGGCTTTGGAAATTGAATAGTTCCTTTATTAATTGGTGCTCCTGATATAAGTTTCCCTCGGATAAATAATATAAGCTTCTGACTTTTACCTCCTTCCTTTTTTCTCCTAATTAGTTCCAGGATAGTGGAAGGGGGTGCTGGAACCGGTTGGACTGTTTATCCTCCTTTAAGTAGAAGAATCGGTCATAGTGGGGCCTCTGTAGATATAGCAATTTTTTCTCTTCACTTAGCAGGAATATCTTCTATTCTGGGGGCTATTAATTTTATTACTACGATTTTTAATATACGATCTTCGGGCTTATCTATGGAACGAGTAAGATTATTCGTATGATCTATCCTAGTTACAGTTTTTTTACTACTTCTATCACTTCCTGTGCTAGCAGGAGCTATTACTATACTTTTGACTGATCGGAATTT
08 Jeju Spirostoma japonicum japonicum
TATATTTTATTTGGTATATGATCTGGTTTAGTCGGGACTGCGTTAAGTTTACTAATTCGTGCTGAATTAGGCCAACCTGGTGCTTTAAGAGATGACCAGTTATATAATGTTATTGTTACTGCCCATGCATTTGTTATAATTTTTTTTTTAGTAATACCAATAATGATTGGTGGTTTCGGAAATTGATTAGTTCCGTTAATGCTTGGTGCTCCTGACATAGCTTTCCCCCGGCTTAATAACATAAGTTTTTGGCTTCTGCCTCCATCCCTTTGTTTACTATTATCTTCAGCAGCTGTAGAGGGTGGTGCTGGGACCGGATGGACTGTTTACCCACCATTAGCTGGGAATTTAGCCCATGCAGGGGGTTCTGTTGATTTAGCAATTTTCTCTTTACATTTGGCTGGTGCATCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATCAATATGCGATGACGTGGAATACATTTTGAGCGTCTACCTTTGTTTGTTTGATCTGTTAAAACTACAGCAATCTTATTGCTACTTTCCTTGCCTGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATCGTAATTT
09 Jeju Aegista chejuensis
TACATACTTTTTGGTGTATGATGTGGTATAGTAGGATCTGGTTTATCAATATTAATTCGTATAGAACTAGGGACTTGTAATGTATTAAGGGATAGTCATTTTTTTAATGTAATCGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATTGAATAGTTCCTTTATTAATTGGAGCTCCTGATATAAGTTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCTCCTTCATTTATTTTATTAATTTCTAGAAGGTTAGTTGAGGGTGGAGCTGGTACTGGATGAACAGTATATCCACCTTTAAGTTCTATTGTAGGTCATAGAGGTGCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTGGCTGGGATATCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTTTTAATATACGTAGTCCAGGAATTTCATTAGAACGAATAAGTTTATTTGTATGATCTATTTTAATTACTGTATTTTTATTACTTTTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTGCTTACTGATCGAAATTT
10 Jeju Aegista chejuensis
TACATACTTTTTGGTGTATGATGTGGTATAGTAGGATCTGGTTTATCAATATTAATTCGTATAGAACTAGGGACTTGTAATGTATTAAGGGATAGTCATTTTTTTAATGTAATCGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATTGAATAGTTCCTTTATTAATTGGAGCTCCTGATATAAGTTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCTCCTTCATTTATTTTATTAATTTCTAGAAGGTTAGTTGAGGGTGGAGCTGGTACTGGATGAACAGTATATCCACCTTTAAGTTCTATTGTAGGTCATAGAGGTGCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTGGCTGGGATATCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTTTTAATATACGTAGTCCAGGAATTTCATTAGAACGAATAAGTTTATTTGTATGATCTATTTTAATTACTGTATTTTTATTACTTTTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTGCTTACTGATCGAAATTT

Posted on September 28, 2022 12:09 AM by pintail pintail | 0 comments | Leave a comment

June 11, 2022

Sinanodonta luata from South Korea has so many different shapes.

Sinanodonta luata from South Korea has so many different shapes.

Sinanodonta lauta has so many different lateral shapes and thicknesses that it is difficult to see it as a single species.

As other freshwater clams in South Korea show various shapes, it is very difficult to distinguish the species.

For this reason, it seems that many scholars in the past have recorded various species of freshwater clams of the genus Sinanodonta, including Sinanodonta lauta.

From December 2019 until now, with the help of Jae-Hoon Kim and Su-Min Seong, freshwater clams from all over South Korea were collected and the COI gene of mtDNA was analyzed. As a result, we collected photos of individuals identified as Sinanodonta lauta.

It's amazing to see so many different shapes.

Posted on June 11, 2022 09:10 AM by pintail pintail | 1 observation | 0 comments | Leave a comment

June 10, 2022

The specimen collected on January 1, 2020 in South Korea is concluded to be Sinandonta woodiana.

Freshwater mussels (Bivalvia: Unionidae) from the rising sun (Far East Asia): Based on phylogeny, systematics, and distribution (2020, Manuel Lopes-Lima et al.), I will tell the story below.

(Sinanodonta cf. woodiana 1) mentioned in the above paper is a very close relative of Sinanodonta lauta. and (Sinanodonta cf. woodiana 2) was recently recorded as Sinanodonta woodiana by Lopes et al.

The specimen collected on January 1, 2020 in South Korea is concluded to be Sinandonta woodiana.

Posted on June 10, 2022 03:41 AM by pintail pintail | 1 observation | 0 comments | Leave a comment

June 09, 2022

Sinanodonta woodiana

Sinanodonta woodiana has been documented for several traits, but it seems that it has recently been confirmed as a single species.
In a paper on an individual recently discovered in Iraq and a paper published in China in 2022, Sinanodonta woodiana is expressed as a group with the same COI gene.

Below is a partial sequence of the COI gene of Sinanodonta woodiana that I analyzed in 2020.

2020_02_25_39_LCO22me2.ab1 1318
CCCGATATAAATTGGAATCAATCTAGCATTATGGTCAGGTTTGGTTGGGTTAGCTTTAAGTCTTTTA
ATTCGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTT
ACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTG
ATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGT
TACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTG
AACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTT
CTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATA
CGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTT
TATTAGTTGCTGCTTTGCCTGTTTTAGCACGGGCTATTACAATGCTTCTTACCGATCTTAATTTAAAT
ACTTCATTCTTTGACCCAACTGGGGGAGGAGACCCTATTTTGTATATGCCTCTATTTTGATTTTTTG
GTCACCCTGAAGGTAGAACAATCGTACAAGAGGTGAGGTCGAGTGGACTATGCGGATATGCACCA
AAAGCGTATCCGGCATGATAGCGATAGGGGAGGATCAAGACGTAATCCAAGAACATCTCCCGCCG
GATGAGTGAAAGAGCTGAACGAGGTCACACGGCGTGCGTAACGCGTAGTAGAGAAGCAGACATA
GGAAGCGCCGGAGACGCAGAGTTTTGGGCCCGGACTTCCGTGTGGTCTGGAGGGCCAGATAAAG
TGACAATCAAAGGACGACCAAGCTGAGACGGACTGTTTGTACGGAGCGAGGCCTGACGTTCAAA
GCGAATATAGGATTCGACCAGCAGACAGCTCTGGTAGATTTAGGTACATCGGAGTCGGCCGCACAT
AACGGGCTCGGTGGTGTGGTGCGCGAGTGAAGGGACGCAGGCGGGGTTAGAGGGTACCGAAGGC
GAGAAGGGAAATTCACGAGGGGTTGAGGTGAGTCGCGTGCGAGACGCGTTTAGGGGCAGAGTCG
TCGGCAACCGGCGATAGTAAATTGGGGGAAAGGACAAATGTCGACGGGGGACTTCCGAACGGTG
TGCCGGCATCGGACCGGAATTTAGAGAGTGTTGGGAGAAGCAGTGGGGAGAGGCACGTGGCGC

Posted on June 09, 2022 10:56 AM by pintail pintail | 0 comments | Leave a comment

Sinanodonta cf. woodiana 2 is a Sinanodonta woodiana?

Sinanodonta cf. woodiana 2 is a Sinanodonta woodiana?

Lopes-Lima, M. In the el al (2019) paper, Sinanodonta woodiana was divided into two groups, including Russia and the northern group (Sinanodonta cf. woodiana 2), and the southern group including Southeast Asia (Sinanodonta cf. woodiana 1).

I found a herd with the same COI gene (Sinandonta cf. woodiana 2) in Seosan and Boseong, Korea. That's why inaturalist records it that way. On the other hand, (Sinandonta cf. woodiana 1) is recorded in inaturalsit as Sinanodonta woodiana.

However, in 2021, Lopes et al recorded the same COI gene that I observed in Seosan as Sinanodonta woodiana in the NCBI.

https://www.ncbi.nlm.nih.gov/nuccore/MZ512215
Lopes-Lima,M., Gurlek,M.E., Kebapci,U., Sereflisan,H., Yanik,T., Mirzajani,A., Neubert,E., Prie,V., Teixeira,A., Gomes-Dos-Santos,A., Barros-Garcia,D., Bolotov,I.N., Kondakov,A.V., Vikhrev,I.V., Tomilova,A.A., Ozcan,T., Altun,A., Goncalves,D.V., Bogan,A.E. and Froufe,E.

Then, can it be regarded as Sinanodonta woodiana (Sinanodonta cf. woodiana 2) that lives in temperate regions including Russia and Korea?

So, what species should be recorded (Sinanodonta cf. woodiana 1) in the tropics of Southeast Asia and southern China?

The phylogenetic tree is posted on the Hangul page that I run.

https://cafe.naver.com/yangpakor/43562

Posted on June 09, 2022 02:26 AM by pintail pintail | 0 comments | Leave a comment

April 01, 2022

The Korean and Chinese species recorded as "Corbicula felnouilliana" are different.

The Korean and Chinese species recorded as "Corbicula felnouilliana" are different.

Jaehoon Kim told me that Corbicula felnouilliana from China and Corbicula felnouilliana from Korea are completely different in appearance.
So, when I drew a phylogenetic tree with the COI gene listed in the NCBI, it was confirmed that it was a completely different group.
The group previously recorded as Corbicula felnouilliana in Korea appears to be a completely different species.

The phylogenetic tree can be viewed on the page below.
https://cafe.naver.com/yangpakor/42666

DQ285578.1 Corbicula lamarckiana
TTTTAGGGTAATTATTCGAATGGAACTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCAGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATACGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
19 LCO1 D11.ab1
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNNCTATNCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
11 LCO1 D10.ab1
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATNCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGNANATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACNATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGAGCTC
12 LCO1 E10.ab1
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAANAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATNCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGAGCTC
1114 GoBook 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 03
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GoBook 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HG 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-A
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTATTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAAAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 GRCo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 NJCo 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTANATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATANCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 05
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNNAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Najoo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Seosan 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 04
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo A
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGNTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATNCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Wanjoo C
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211240.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211241.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211242.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGAGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211243.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTCAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATACGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211244.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCCTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCCTGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211245.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTATTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211246.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCGATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211247.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATCCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211248.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGTTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211249.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTGACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211250.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211251.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211252.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATACCTGTATTAGCTGGAGCTC
2018 KC211253.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTATTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211254.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTGTTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211255.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211256.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTACTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211257.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211258.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211259.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGTTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211260.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTGGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211261.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211262.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211263.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211264.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211265.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAATTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211266.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211267.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211268.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211269.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211270.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211271.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGAACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211272.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211273.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211274.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211275.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211276.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTGAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211277.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211279.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATAGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211280.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATGGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211281.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211282.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATATTGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211283.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211284.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211285.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAACGCCTGTGTTAGCTGGGGCTC
2018 KC211286.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211287.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTTATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211288.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211289.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCCGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCTATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTACAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1116 DJCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC
1116 DJCo-02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTANTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 DJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 DJCo-05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-06
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGGGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 GRCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 GRCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 GRCo-03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 NJCo-01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 NJCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 NJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC

Posted on April 01, 2022 11:05 PM by pintail pintail | 0 comments | Leave a comment

February 10, 2022

A phylogenetic tree of the genus Sinanodonta

I tried to draw a phylogenetic tree of the genus Sinanodonta. It was based on the data on the NCBI and the data I collected in Korea and analyzed myself.
I've been doing a little bit of analysis since 2019, so there's a lot of material I haven't found this time around. However, I was able to observe approximately Sinanodonta lauta, Sinanodonta cf woodiana 2, and Sinanodonta schrenckii in Korea.
And the species recorded as Sinanodonta woodiana (Sinanodonta cf. woodiana 1) from China, Southeast Asia and Europe appears to be a very close relative of Sinanodonta lauta. It was marked by guessing its location on the phylogenetic tree.

https://pintail1.ivyro.net/04homepage/2022/02_feb/20220211.htm
https://cafe.naver.com/yangpakor/41565

If I could afford it, I would like to draw a phylogenetic tree by comparing all long sequences, but when drawing a phylogenetic tree comparing all Korean freshwater clams, only 265 nucleotide sequences are being compared. I also drew a phylogenetic tree. As a result, it was found that there was no significant difference between the phylogenetic tree drawn with 265 and the phylogenetic tree drawn with 529.

Sinanodonta cf. woodiana 1, Sinanodonta cf. I hope that the classification of woodiana 2 will be sorted out soon.

MN809939.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
MT013157.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978737.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978742.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATAGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGTGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGATCTCCTGGTTTGGTTGCTGAGCGGATCCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
MG463050.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTGCCAGCGTTATTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCTGGTGCTTCGTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTCTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KJ434487.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGGAGGCTTTTAGGGGATGATCAGCTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTGCTTGTGCCAGCGTTATTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
LC651630.1 Sinanodonta sp.
CGAGCAGAGTAGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTTCGGCTCATGCTTTAATAATAATTTTCTTCTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAAATCGTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTAGCAGCGTTATTTTTATTTTTAAGATCTTCTTTAGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KX051328.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTACCAGCGTTATTTTTATTATTAAGATCTTCTTTAGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KU891641.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTAATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTACCAGCGTTATTTTTATTATTAAGATCTTCTTTAGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978744.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTTTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGGTTAATTCCGTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTACTATTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
MG463064.1 Sinanodonta joreti
CGAGCGGAATTGGGTCAGCCCGGGAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATGATTGGGGGGTTTGGAAATTGGTTAATTCCCTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGTGCTTCTGTGGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTATTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
KJ434489.1 Sinanodonta woodiana
CGAGCGGAATTGGGTCAGCCCGGGAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATGATTGGGGGGTTTGGAAATTGGTTAATTCCCTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTGGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
KJ434486.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
MG581711.1 Sinanodonta aff. woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
AF468683.1 Anodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
MG463054.1 Sinanodonta angula
CGAGCAGAGTTAGGTCAACCAGGAAGGTTGTTGGGGGATGATCAGTTATATAATGTCATTGTGACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTAATACCTATGATAATTGGGGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGACATGGCTTTCCCTCGTTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTGCTTTTGAGGTCGTCTTTGGTGGAGAGGGGTGTTGGCACTGGGTGAACGGTATATCCTCCCTTGTCTGGGAATGTTGCCCATTCCGGGGCTTCTGTCGATTTAGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCTATCCTGGGGGCTATTAATTTTATTTCTACTGTTGGGAACATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATTCCTTTGTTTGTGTGAGCTGTTACAGTTACAGCTGTTTTACTGGTCGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTGACGGATCGTA
MG463057.1 Sinanodonta angula
CGAGCAGAGTTAGGTCAACCAGGAAGGTTGTTGGGGGATGATCAGTTATATAATGTTATTGTGACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTAATACCTATGATAATTGGGGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGACATGGCTTTCCCTCGTTTAAATAATTTAAGGTTTTGGCTACTTGTGCCAGCGTTGTTTTTGCTTTTGAGGTCGTCTTTGGTGGAGAGGGGTGTTGGCACTGGGTGAACGGTATATCCTCCCTTGTCTGGGAATGTTGCCCATTCCGGGGCTTCTGTCGATTTAGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCTATCCTGGGGGCTATTAATTTTATTTCTACTGTTGGGAACATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATTCCTTTGTTTGTGTGAGCTGTTACAGTTACAGCTGTTTTACTGGTCGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTGACGGATCGTA
MG463066.1 Anodonta lucida
CGAGCAGAATTAGGTCAACCGGGAAGGTTGTTGGGGGATGATCAGCTATACAATGTTATTGTAACGGCTCATGCTTTTATGATAATTTTCTTTTTGGTAATACCTATAATAATTGGGGGATTTGGAAATTGGCTCATTCCTTTGATAATTGGGGCTCCTGATATAGCTTTCCCTCGTTTAAATAATTTAAGATTTTGGTTACTTGTGCCAGCGTTATTTTTGCTTTTAAGGTCATCTTTGGTGGAGAGGGGTGTTGGTACTGGGTGAACGGTGTATCCTCCTTTGTCTGGGAATGTTGCTCATTCCGGGGCTTCTGTTGATTTAGCTATCTTCTCTTTACACCTGGCCGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATCTCTACTGTTGGGAATATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATCCCTTTGTTTGTGTGAGCTGTTGCAGTTACAGCTGTTTTATTGGTCGCTGCTTTGCCTGTTTTAGCTGGGGCTATCACAATGCTTCTTACGGATCGTA
LC519023.1 Sinanodonta ogurae
CGAGCAGAGTTGGGTCAGCCGGGAAGGCTTTTAGGGGATGATCAGTTATATAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTGGTTATGCCTATGATGATTGGTGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGGTTTTGATTACTTGTGCCAGCACTGTTTTTGCTTCTAAGGTCTTCTTTGGTTGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCTCCTTTATCAGGGAATGTTGCTCACTCTGGTGCTTCCGTTGATTTAGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCGTCTATTTTAGGTGCTATTAATTTTATTTCTACTGTTGGAAATATACGATCTCCTGGTTTGGTTGCCGAGCGAATTCCTTTATTTGTATGAGCTGTCACAGTAACAGCTGTTTTGTTGGTTGCTGCTTTGCCTGTGTTAGCAGGGGCTATTACAATACTTCTTACGGATCGTA
MK574233.1 Sinanodonta schrenkii
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGGAATTGGCTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
MK574232.1 Sinanodonta schrenkii
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTGTTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACTGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
LC519017.1 Sinanodonta lauta
CGAGCGGAGTTAGGTCAGCCTGGAAGGTTACTGGGGGACGATCAGCTGTATAATGTCATTGTTACGGCTCATGCTTTCATAATAATTTTTTTCTTGGTTATACCAATAATAATTGGGGGATTTGGGAATTGGCTTATTCCTCTAATAATTGGGGCTCCTGATATAGCTTTCCCTCGATTGAATAACTTGAGGTTTTGGCTGCTTGTACCAGCATTATTTTTGTTGTTAAGATCCTCTTTGGTAGAGAGGGGTGTTGGCACTGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCCGGTGCTTCTGTAGATTTGGCCATCTTTTCTTTGCACTTAGCTGGTGCTTCGTCAATTTTAGGGGCTATCAATTTTATTTCTACTGTAGGAAATATACGATCTCCAGGCTTGGTTGCTGAGCGAATTCCCTTATTTGTATGGGCTGTTACAGTAACAGCTGTTTTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGCGCTATTACGATGCTTCTTACGGATCGAA
LC519016.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCTGGAAGGCTGTTAGGAGATGATCAGTTATATAATGTTATCGTTACGGCTCATGCCTTTATGATAATTTTCTTTTTAGTTATACCAATGATAATTGGGGGATTTGGAAATTGACTTATTCCTTTGATAATTGGGGCTCCTGATATGGCCTTTCCTCGATTTAACAATTTAAGGTTTTGGCTGCTTGTACCAGCATTGTTTTTATTATTAAGATCCTCTTTGGTAGAAAGAGGTGTTGGTACTGGGTGAACAGTATATCCGCCTTTGTCTGGGAATGTTGCTCATTCCGGTGCTTCTGTAGATTTGGCCATTTTTTCTTTGCATTTGGCTGGTGCTTCATCAATTTTGGGGGCTATTAATTTTATTTCTACTGTAGGGAATATACGGTCTCCAGGTTTGGTTGCTGAGCGAATTCCCTTATTCGTATGGGCTGTGGCTGTAACAGCTGTTCTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGTGCCATTACGATGCTTCTTACGGACCGTA
LC519021.1 Sinanodonta calipygos
CGAGCAGAGTTGGGTCAGCCTGGAAGGCTGTTAGGAGATGATCAGCTATATAATGTTATTGTTACGGCTCATGCCTTTATAATAATTTTCTTTTTAGTTATACCAATGATAATTGGGGGATTTGGAAATTGACTTATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGATTAAATAATTTAAGGTTTTGGCTGCTTGTACCAGCATTGTTTTTATTATTAAGATCCTCTTTGGTAGAAAGAGGTGTTGGTACTGGGTGAACAGTATATCCGCCTTTGTCTGGGAATGTTGCTCATTCCGGTGCCTCTGTAGATTTGGCCATTTTTTCTTTGCATTTAGCTGGTGCTTCATCAATTTTGGGGGCTATTAATTTTATTTCCACTGTAGGGAATATACGGTCTCCAGGTTTGGTTGCTGAGCGAATTCCCTTATTCGTATGGGCTGTGGCTGTAACAGCTGTTCTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGTGCCATTACGATGCTTCTTACGGATCGTA
MK574183.1 Anodonta cygnea
CGAGCTGAATTGGGTCAGCCGGGGAGGTTATTGGGGGATGATCAGTTATATAATGTAATTGTTACAGCTCATGCATTTATGATAATTTTTTTTTTGGTGATGCCAATAATGATTGGGGGGTTTGGTAATTGGCTTATTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTATTGGTGCCAGCTTTATTTCTGTTATTAAGATCGTCATTGGTAGAGAGTGGTGTTGGTACTGGGTGGACGGTATACCCTCCTTTGTCTGGGAATGTTGCTCATTCTGGAGCTTCAGTAGATCTGGCCATTTTTTCCTTACATCTTGCTGGTGCTTCATCAATTTTAGGGGCTATTAATTTTATTTCTACTGTTGGAAATATACGATCTCCAGGCTTAGTCGCTGAGCGAATTCCTTTGTTTGTATGGGCTGTTACGGTAACAGCTGTATTATTGGTTGCTGCTTTGCCTGTTTTAGCTGGTGCTATTACAATATTATTGACTGATCGTA
MK574178.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGGGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTTTTTCTAGTAATACCGATGATGATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTTCCTCGATTAAATAATTTAAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTGGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCTCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCCGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGATCGTA
MK574180.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGAGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTCTTTCTAGTAATACCGATGATAATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTCCCTCGATTGAATAATTTGAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTTGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCCCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCTGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGACCGTA
MK574179.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGAGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTCTTTCTAGTAATACCGATGATAATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTCCCTCGATTGAATAATTTGAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTTGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCCCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCCATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCTGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGACCGTA
KOREA Sep 05
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue06
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue50
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue23
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTGGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA AS01
CGAGCAGAGTTGGGTCAACCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATTATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGTGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
KOREA 31-2
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA 43
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTACTGTACGAAATATACGGTCTCCTGGGTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAATTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Sep 18
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA 39
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCACGGGCTATTACAATGCTTCTTACCGATCTTA
KOREA 20
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTCCCAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATCCTCTTTTTAGTTATGCCTATAATAATTGGGGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACTGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
KOREA IS01
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
KOREA Blue13
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA

Posted on February 10, 2022 04:30 AM by pintail pintail | 1 observation | 0 comments | Leave a comment

February 06, 2022

2022 Korean freshwater clams

Since November 2019, I have been exploring freshwater clams in Korea with Jae-Hoon Kim and Su-Min Seong. I introduce 28 kinds of Korean freshwater clams that have been identified through mtDNA analysis so far. I think there may be one more species in the genus Corbicula, but the shell has been obtained, but the genetic information has not yet been obtained.

https://pintail1.ivyro.net/04homepage/2022/02_feb/20220206.htm

2021 BSCo01 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 BSCo04 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 HDCo01 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 HDCo03 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 JJCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJCo01 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0729 75 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0808 86 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 KJH Asan15 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 Pisidium coreanum
GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAG-GTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATT-TTTTGACTAC
2021 SSCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20210808 151
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211114 GB-01
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-02
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTANATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-03
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 GB-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 HG-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HG-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 HG-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HM-A
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HM-B
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 JS-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 JS-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 MK
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 MK-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 MK-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 WS-A
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
20211114 WS-B
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
20211114 WS-C
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGANAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCNCTATCTGGGAACGTANCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACNTTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
20211116 158
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 159
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCNGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCGNGG-ATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 160
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAAANAN-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCANTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 161-2
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAANATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 162-1
GGGAATTGGCTTATTCCTCTAATGATNGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATANCTNNANATTTTGGCTGCTTGNGCCNGNTTTGNTTTTGNTATTAAGATCNNCTTTGGTANAANGAG-GTGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCNNTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211116 162-2
GGGAATTGGCTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211116 164
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTNNNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 165-1
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 166-1
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211116 DJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-06
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-07
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o1i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o2i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o3i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRSi 01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
20211116 GRSi 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCANCGTTGTTTTTATTATTAAGATCTTCTTTGGTANAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTANCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTANGTGCTATTAACT-TTATTTCTAC
20211116 HD01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 KMRCFW222
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 KMRCFW224
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211116 KMRCFW225
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTANGGNCNTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACANTGTATCCCCCTTTGTCANGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KMRCFW226
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KMRCFW245
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTGAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCCTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTGCACCTTGCTGGTGCTTCATCGATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KS-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KS-03
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTACACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 NJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 NJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 NJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 WJ-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211215_Aculamprotula sp_ND01
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211215_Aculamprotula sp_ND02
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211215_Buldowskia_flavotincta_Ane01.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Buldowskia_flavotincta_Ane02.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Buldowskia_flavotincta_Ane03.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Koreosolenaia sitgyensis_ND03
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
20211215_Lanceolaria sp_ND04
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211215_Nodularia breviconcha_HS01
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre01
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre02
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre03
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_GJ01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia douglasiae_GJ03
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia douglasiae_HR01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia sp_Uni01
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC
20211215_Nodularia sp_Uni03
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC
Aculamprotula sp 210729 66
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Aculamprotula sp 210729 69
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Aculamprotula sp JJ01
GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Anemina arcaeformis 200522 AD21
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Asan03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Black13
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Black6
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Blue10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Sep 26
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina euscaphys 2020 MY01
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATT-TTATTTCTAC
Anemina euscaphys Black12
GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATT-TTATTTCTAC
Anemina euscaphys Black14
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATT-TCATTTCTAC
Anemina euscaphys Black15
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATT-TTATTTCTAC
Ansung 01
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 02
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 04
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 06
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 09
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 11
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
BSPc01 Potamocorbula amurensis
GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTG-GTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACT-TTTATAGGAC
Buldowskia flavotincta Buyeo 01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta SK01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta sk02
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta SK06
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia iwakawai 200225 18
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 200225 58
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 KR01
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 KR02
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 SC01
GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 40
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 55
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 fatSeosan2
GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini Blue28
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini Blue31
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini us23
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Cristaria plicata 2019
GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATT-TTATTTCTAC
HYTr Musculium lacustre
GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAG-GAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATT-TTTTAACTAC
Inversiunio verrucisus 2020 BS04
GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGG-GTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
KOREA AF457992.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
KOREA EU090397.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATT-TTGTTGTCAC
KOREA EU090399.1 Corbicula sp.
GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
Koreosolenaia sitgyensis 2020 BS02
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Koreosolenaia sitgyensis 210729 64
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
Koreosolenaia sitgyensis 210729 65
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
Lamprotula leaii 2020 BS06
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Lamprotula seomjinensis 210729 152
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Lanceolaria acrorrhyncha 2019
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
Lanceolaria sp MK01
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
Lanceolaria sp MK02
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
NCBI DQ264395.1 Limnoperna fortunei
GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTG-GAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATT-ATATTACTAG
NCBI MT020521.1 Aculamprotula coreana
GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGG-GTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATT-TTATCTCTAC
Nodularia breviconcha 200522 JH05
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 200522 JH06
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 200522 YS03
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha 200522 YS04
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha 2020 BS07
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 210729 71
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha Blue18
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha Blue32
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha Blue35
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha Blue43
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha HC02
GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha KJ02
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia douglasiae 200225 ADND3
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 200225 BYND2
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 2019
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 210729 154
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 210729 70
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae Blue17
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae CH01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae JN01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae LUS02
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae sk03
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Sinanodonta cf woodiana 2 200225 39
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGG-GCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATT-TTATTTCTAC
Sinanodonta cf woodiana 2 Blue40
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGG-GCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATT-TTATTTCTAC
Sinanodonta lauta 1
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 200225 31
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 200225 43
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 2019
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 2019 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta AS01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue23
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue33
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue50
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue6
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Sep 05
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Sep 18
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta schrenckii Blue13
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200225 20
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200225 21
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200522 IS01
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Uni0220211215_Nodularia sp_Uni02
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC

Posted on February 06, 2022 07:57 AM by pintail pintail | 1 observation | 0 comments | Leave a comment